BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15113

Title: Solution Structure of the Rous Sarcoma Virus Nucleocapsid Protein:muPsi RNA Packaging Signal Complex   PubMed: 17070546

Authors: Zhou, J.; Summers, M.

Citation: Zhou, J.; Bean, R.; Vogt, V.; Summers, M.. "Solution Structure of the Rous Sarcoma Virus Nucleocaspid Protein:muPsi RNA Packaging Signal Complex"  J. Mol. Biol. 365, 453-467 (2007).

Assembly members:
ZN, non-polymer, Formula weight is not available
muPsi_RNA, polymer, 75 residues, Formula weight is not available
Nucleocapsid_(NC)_Protein, polymer, 61 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: 11886   Superkingdom: Viruses   Kingdom: not available   Genus/species: Alpharetrovirus Rous sarcoma virus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
muPsi_RNA: CUGCCCUCAUCCGUCUCGCU UAUUCGGGGAGCGGACGAUG ACCCUAGUAGAGGGGGCUGC GGCUUAGGAGGGCAG
Nucleocapsid_(NC)_Protein: GRARGLCYTCGSPGHYQAQC PKKRKSGNSRERCQLCNGMG HNAKQCRKRDGNQGQRPGKG L

Data sets:
Data typeCount
13C chemical shifts88
1H chemical shifts567

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all