BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15080

Title: U2 snRNA stem I from S. cerevisiae   PubMed: 17242306

Authors: Sashital, Dipali; Venditti, Vincenzo; Angers, Cortney; Cornilescu, Gabriel; Butcher, Samuel

Citation: Sashital, Dipali; Venditti, Vincenzo; Angers, Cortney; Cornilescu, Gabriel; Butcher, Samuel. "Structure and thermodynamics of a conserved U2 snRNA domain from yeast and human"  RNA 13, 328-338 (2007).

Assembly members:
Yeast_U2_Stem_I, polymer, 20 residues, Formula weight is not available

Natural source:   Common Name: Yeast   Taxonomy ID: 4932   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Saccharomyces cerevisiae

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
Yeast_U2_Stem_I: GGUUUGCCUUUUGGCUUACC

Data sets:
Data typeCount
13C chemical shifts133
1H chemical shifts177

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Yeast U2 stem I1

Entities:

Entity 1, Yeast U2 stem I 20 residues - Formula weight is not available

1   GGUUUGCCUU
2   UUGGCUUACC

Samples:

sample_1: Yeast U2 Stem I 0.5 mM; H2O 90%; sodium chloride 50 mM; D2O 10%

sample_2: Yeast U2 Stem I 0.5 mM; D2O 99.99%; sodium chloride 50 mM

sample_3: Yeast U2 Stem I, [U-100% 13C; U-100% 15N], 0.4 mM; D2O 99.99%; sodium chloride 50 mM

sample_4: Yeast U2 Stem I, [U-100% 13C; U-100% 15N], 0.4 mM; D2O 99.99%; sodium chloride 50 mM; potassium chloride 10 mM; Pf1 phage 17 w/v

sample_conditions_1: ionic strength: 50 mM; pH: 7; pressure: 1 bar; temperature: 283 K

sample_conditions_2: pH: 7.0; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D 1H-1H COSYsample_3isotropicsample_conditions_2
3D HCCH-TOCSYsample_3isotropicsample_conditions_2
2D HNCOsample_3isotropicsample_conditions_2
2D J-modulated CT HSQCsample_3isotropicsample_conditions_2
2D hd-ECOSY-TROSYsample_3isotropicsample_conditions_2
2D J-modulated CT HSQCsample_4anisotropicsample_conditions_2
2D hd-ECOSY-TROSYsample_4anisotropicsample_conditions_2

Software:

xwinnmr, Bruker Biospin - collection, processing

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment, data analysis

CNS, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker DMX 750 MHz
  • Varian INOVA 900 MHz

Related Database Links: