BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 11607

Title: Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish

Authors: Otsu, Maina; Norose, Nao; Arai, Nao; Terao, Ryo; Kajikawa, Masaki; Okada, Norihiro; Kawai, Gota

Citation: Otsu, Maina; Norose, Nao; Arai, Nao; Terao, Ryo; Kajikawa, Masaki; Okada, Norihiro; Kawai, Gota. "Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish"  Not known ., .-..

Assembly members:
RNA_(34-MER), polymer, 34 residues, 10859.578 Da.

Natural source:   Common Name: zebrafish   Taxonomy ID: 7955   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Denio Renio

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA_(34-MER): GGCGCUUUGACACAAUCUAC AUUGUAAAAGCGCC

Data sets:
Data typeCount
13C chemical shifts33
1H chemical shifts97

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (34-MER)1

Entities:

Entity 1, RNA (34-MER) 34 residues - 10859.578 Da.

1   GGCGCUUUGA
2   CACAAUCUAC
3   AUUGUAAAAG
4   CGCC

Samples:

ZfL2-1-34_D2O: RNA (34-MER) 0.3 mM; RNA (34-MER), [U-100% 13C; U-100% 15N], 0.26 mM; sodium phosphate 20 mM; sodium chloride 50 mM; D2O, [U-2H], 100%

ZfL2-1-34_H2O: RNA (34-MER), [U-13C; U-15N]-Ade, 0.18 mM; RNA (34-MER), [U-13C; U-15N]-Gua, 0.19 mM; sodium phosphate 20 mM; sodium chloride 50 mM; H2O 95%; D2O, [U-2H], 5%

sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYZfL2-1-34_D2Oisotropicsample_conditions_1
2D 1H-1H TOCSYZfL2-1-34_D2Oisotropicsample_conditions_1
2D 1H-13C HSQCZfL2-1-34_D2Oisotropicsample_conditions_1
2D 1H-13C HSQCZfL2-1-34_D2Oisotropicsample_conditions_1
2D 1H-13C HSQCZfL2-1-34_H2Oisotropicsample_conditions_1
2D 1H-13C TROSYZfL2-1-34_D2Oisotropicsample_conditions_1
2D 1H-13C TROSYZfL2-1-34_D2Oanisotropicsample_conditions_1

Software:

TOPSPIN v2.1, Bruker Biospin - collection, processing

CNSSOLVE v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure solution

SPARKY v3.114, Goddard - peak picking

X-PLOR_NIH v2.32, Schwieters, Kuszewski, Tjandra and Clore - grid search

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker DRX 600 MHz
  • Bruker Avance 800 MHz

Related Database Links: