BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 11176

Title: Solution Structure of RNA aptamer against AML1 Runt domain

Authors: Nomura, Yusuke; Fujiwara, Kazuya; Chiba, Manabu; Fukunaga, Jun-ichi; Tanaka, Yoichiro; Iibuchi, Hiroaki; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Kozu, Tomoko; Sakamoto, Taiichi

Citation: Nomura, Yusuke; Fukunaga, Jun-ichi; Tanaka, Yoichiro; Fujiwara, Kazuya; Chiba, Manabu; Iibuchi, Hiroaki; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko. "A novel high affinity RNA motif that mimics DNA in AML1 Runt domain binding"  . ., .-..

Assembly members:
AML22, polymer, 22 residues, 7032 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
AML22: GGACCCACCACGGCGAGGUC CA

Data sets:
Data typeCount
1H chemical shifts105

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1AML221

Entities:

Entity 1, AML22 22 residues - 7032 Da.

1   GGACCCACCA
2   CGGCGAGGUC
3   CA

Samples:

sample_1: AML22 0.6 mM; sodium phosphate 10 mM; D2O 100%

sample_2: AML22, [U-100% 13C; U-100% 15N], 0.5 mM; sodium phosphate 10 mM; D2O 100%

sample_3: AML22 0.6 mM; sodium phosphate 10 mM; H2O 90%; D2O 10%

sample_4: AML22, [U-100% 13C; U-100% 15N], 0.5 mM; sodium phosphate 10 mM; H2O 90%; D2O 10%

sample_conditions_1: pH: 6.5; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-1H TOCSY no.1sample_1isotropicsample_conditions_1
2D 1H-1H TOCSY no.2sample_3isotropicsample_conditions_1
2D 1H-1H NOESY no.1sample_1isotropicsample_conditions_1
2D 1H-1H NOESY no.2sample_3isotropicsample_conditions_1
2D HCCH-TOCSYsample_2isotropicsample_conditions_1
2D HCCH-COSYsample_2isotropicsample_conditions_1
2D HNN-COSYsample_4isotropicsample_conditions_1

Software:

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker DRX 600 MHz

Related Database Links: