BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 10018

Title: 1H Chemical Shift Assignments for LINE RNA   PubMed: 17000640

Authors: Nomura, Yusuke; Baba, Seiki; Nakazato, Shinta; Sakamoto, Taiichi; Kajikawa, Masaki; Okada, Norihiro; Kawai, Gota

Citation: Nomura, Yusuke; Kajikawa, Masaki; Baba, Seiki; Nakazato, Shinta; Imai, T.; Sakamoto, Taiichi; Okada, Norihiro; Kawai, Gota. "Solution structure and functional importance of a conserved RNA hairpin of eel LINE UnaL2"  Nucleic Acids Res. 34, 5184-5193 (2006).

Assembly members:
LINE36, polymer, 36 residues, Formula weight is not available

Natural source:   Common Name: Japanese eel   Taxonomy ID: 7937   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Anguilla Japonica

Experimental source:   Production method: enzymatic synthesis

Entity Sequences (FASTA):
LINE36: GGUUGUACGUCGCUUUGGAU AAAAGCGUCUGCGACC

Data sets:
  • assigned_chemical_shifts
Data typeCount
1H chemical shifts178

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA hairpin of eel LINE1

Entities:

Entity 1, RNA hairpin of eel LINE 36 residues - Formula weight is not available

1   GGUUGUACGU
2   CGCUUUGGAU
3   AAAAGCGUCU
4   GCGACC

Samples:

sample_1: LINE36 1.0 ± 0.1 mM

condition_1: pH: 6.0; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYsample_1not availablecondition_1
2D TOCSYsample_1not availablecondition_1
DQF-COSYsample_1not availablecondition_1
HP-COSYsample_1not availablecondition_1
HCPsample_1not availablecondition_1
HALF FILTERED NOESYsample_1not availablecondition_1
2D HNN-COSYsample_1not availablecondition_1
2D HSQCsample_1not availablecondition_1
2D TROSYsample_1not availablecondition_1

Software:

No software information available

NMR spectrometers:

  • Bruker DRX 600 MHz
  • Bruker DRX 500 MHz

Related Database Links: