BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15856

Title: NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)

Authors: Kruschel, Daniela; Sigel, Roland

Citation: Kruschel, Daniela; Sigel, Roland. "Solution structure of the 5'-splice site of a group II intron ribozyme"  Not known ., .-..

Assembly members:
RNA_(29-MER), polymer, 29 residues, Formula weight is not available

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: in vitro transcription   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA GCAUACUCC

Data sets:
Data typeCount
13C chemical shifts77
15N chemical shifts10
1H chemical shifts221

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (29-MER)1

Entities:

Entity 1, RNA (29-MER) 29 residues - Formula weight is not available

1   GGAGUAUGUA
2   UUGGCACUGA
3   GCAUACUCC

Samples:

sample_1: RNA (29-MER) 0.4-1.2 mM; potassium chloride 10 mM; EDTA 10 uM; MgCl2 0-7 mM; D2O, [U-100% 2H], 100%

sample_2: RNA (29-MER) 0.4-1.2 mM; potassium chloride 10 mM; EDTA 10 uM; MgCl2 0-8 mM; H2O 90%; D2O, [U-100% 2H], 10%

sample_3: RNA (29-MER), [selectively deuterated at 3, ; 2, potassium chloride, ; 3, EDTA, ; 4, D2O, ;

sample_4: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.7 mM; potassium chloride 10 mM; EDTA 10 uM; H2O 90%; D2O, [U-100% 2H], 10%

sample_5: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.7 mM; potassium chloride 10 mM; EDTA 10 uM; Pf1 phage 25.6 mg/ml; H2O 90%; D2O, [U-100% 2H], 10%

sample_6: RNA (29-MER), [U-100% 13C; U-100% 15N], 1.0 mM; potassium chloride 10 mM; EDTA 10 uM; H2O 90%; D2O, [U-100% 2H], 10%

sample_conditions_1: ionic strength: 13.5 mM; pD: 6.8; pressure: 1 atm; temperature: 293 K

sample_conditions_6: ionic strength: 13.5 mM; pD: 6.8; pressure: 1 atm; temperature: 298 K

sample_conditions_7: ionic strength: 13.5 mM; pD: 6.8; pressure: 1 atm; temperature: 303 K

sample_conditions_2: ionic strength: 14 mM; pD: 6.65; pressure: 1 atm; temperature: 278 K

sample_conditions_8: ionic strength: 14 mM; pD: 6.65; pressure: 1 atm; temperature: 283 K

sample_conditions_9: ionic strength: 14 mM; pD: 6.65; pressure: 1 atm; temperature: 293 K

sample_conditions_3: ionic strength: 10 mM; pD: 6.7; pressure: 1 atm; temperature: 293 K

sample_conditions_10: ionic strength: 10 mM; pD: 6.7; pressure: 1 atm; temperature: 298 K

sample_conditions_11: ionic strength: 10 mM; pD: 6.7; pressure: 1 atm; temperature: 303 K

sample_conditions_4: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

sample_conditions_5: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_3isotropicsample_conditions_3
2D 1H-13C HSQCsample_4isotropicsample_conditions_4
2D 1H-15N HSQCsample_4isotropicsample_conditions_5
2D 1H-13C HSQCsample_5anisotropicsample_conditions_4
2D 1H-15N HSQCsample_5anisotropicsample_conditions_5
2D JNN HNN-COSYsample_6isotropicsample_conditions_5

Software:

TOPSPIN v1.3, 2.0, 2.1, Bruker Biospin - processing

SPARKY v3.1, Goddard - chemical shift assignment, data analysis, peak picking

DYANA v1.5, Guntert, Braun and Wuthrich - structure solution

CNSSOLVE v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

X-PLOR NIH v2.16, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker Avance 700 MHz

Related Database Links: