BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15745

Title: Solution structure of stem-loop alpha; of the hepatitis B virus post-transcriptional regulatory element   PubMed: 18263618

Authors: Ohlenschlager, Oliver; Gorlach, Matthias; Schwalbe, Martin

Citation: Schwalbe, Martin; Ohlenschlager, Oliver; Marchanka, Aliaksandr; Ramachandran, Ramadurai; Hafner, Sabine; Heise, Tilman; Gorlach, Matthias. "Solution structure of stem-loop alpha of the hepatitis B virus post-transcriptional regulatory element"  Nucleic Acids Research 36, 1681-1689 (2008).

Assembly members:
RNA, polymer, 22 residues, 7105.313 Da.

Natural source:   Common Name: hepatitis B virus   Taxonomy ID: 10407   Superkingdom: Virus   Kingdom: not available   Genus/species: Orthohepadnavirus Hepatitis B virus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
RNA: GGCUCGCAGCAGGUCUGGAG UC

Data sets:
Data typeCount
13C chemical shifts145
15N chemical shifts50
1H chemical shifts195

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all